Ophelia Ophelia
  • 08-05-2025
  • Biology
High School

What is the correct numerical sequence for unlocking "DNA Structure"?

Answer :

howardclemingtime howardclemingtime
  • 19-08-2024

Answer:

3'TGACGACTACAACTTAATCT

Explanation:

Adenine bonds with thymine; guanine bonds with cytosine. This is the complement DNA sequence.

Answer Link

Other Questions

Describe the specialized characteristics of human red blood cells and explain how
Pentagon KLMNP was dilated with the origin as the center of dilation
A 35 ohm, 55 ohm, and 85 ohm resistor are connected in
Upon being struck by 99.3-nm photons, a metal ejects electrons with a
The Bach fugue’s texture is polyphonic, one of the most challenging types
Find the complement of 27 1/2 degrees. A. 27 1/2 degrees B.
What is the equivalent logarithmic form of an exponential function where [tex]x
In a blueprint, the length (\( l \)) of a rectangular room
Rewrite the sentences. 1. I prepared the table a few minutes ago.
What is the required hydrant pressure on a 6000 GT Cargo vessel?
How can knowledge of nutrition benefit a dental assistant?
In a population of stickleback fish, the presence of body armor is
If a patient was ordered 30 ml of KCl every 2 hours,
How many customers are served at Jiffy Lube service centers across the
An ice cube is placed in a microwave oven. If the oven