Ophelia Ophelia
  • 26-03-2025
  • Biology
High School

What is the correct numerical sequence for unlocking "DNA Structure"?

Answer :

howardclemingtime howardclemingtime
  • 19-08-2024

Answer:

3'TGACGACTACAACTTAATCT

Explanation:

Adenine bonds with thymine; guanine bonds with cytosine. This is the complement DNA sequence.

Answer Link

Other Questions

Which one of the following statements is enough to justify that 169
Which expression is equivalent to [tex]\frac{9}{10}[/tex]? A. [tex]\frac{18}{20}[/tex] B. [tex]\frac{3}{5}[/tex] C. [tex]\frac{27}{30}[/tex]
Fire extinguishers labeled Class K are most appropriate for fires that involve:
A network analyst is booting a PC with Windows 7 installed and
Which of the following is a good practice to protect your mobile
222.7 L = ______________ dL
Search, Identify, Predict, Decide, Execute is a process that can be used
okay smart amazing humans , help ? :((
Keisha has completed 72 math problems in her SHSAT practice workbook. This
The Comfy blanket is regularly priced at $39.99 on Amazon. The website
what helps protect from spear phishing cyber awareness
Which type of insurance protects an agent and even pays claims if
The quotient of [tex]\left(x^4+5x^3-3x-15\right)[/tex] and [tex]\left(x^3-3\right)[/tex] is a polynomial. What is the
identify the characteristics that belong to generalized transduction, specialized transduction, or both.
¿Cuántas diagonales tiene un cuadrado de 64 centímetros de perímetro?