Ophelia Ophelia
  • 12-09-2023
  • Biology
High School

What is the correct numerical sequence for unlocking "DNA Structure"?

Answer :

howardclemingtime howardclemingtime
  • 19-08-2024

Answer:

3'TGACGACTACAACTTAATCT

Explanation:

Adenine bonds with thymine; guanine bonds with cytosine. This is the complement DNA sequence.

Answer Link

Other Questions

In break-even analysis, the contribution margin is defined as: A. Variable cost
What would bore a one-inch hole in a pine log? A. A
For one month, Siera calculated her hometown's average high temperature in degrees
There are only red counters, blue counters, and green counters in a
How do CRISPR arrays in bacterial DNA store information from the history
What is the purpose of the air bubble in the capillary tube?
Which of the following best replaces the question mark in the graphic
How fast would a 67 kg person have to run to have
why was the welfare state introduced in the UK 100 wordsplease help
**Going Underground** **Clark Benson** The following text is the transcript of a
Which of the following pairs of units of measurement are equivalent to
A box is 50 cm long. Which of these is closest to
this problem is involving sig figures. i want to cross check my
**Question 23:** Which of the following pathways is used as an alternative
What is the approximate value of [tex]$913 + 27$[/tex]? A. 34 B.